Zum Menü des literaturcafe.de | Zum Kontextbereich
Toplinks
Social-Media-Icons

Wellers Wahre Worte am Café Tisch
Juli 2000 - Die monatliche Kolumne von Wilhelm Weller


Outing im Weißen Haus
Was Sie schon immer über das Human Genome Project wissen wollten
Wilhelm Weller


Auf diesen Tag hatte ich gebannt gewartet.
     Jener 26. Juni 2000, an dem Bill Clinton zusammen mit Francis Collins und Craig Venter während einer Pressekonferenz im Weißen Haus den erfolgreichen Abschluss des Human Genome Projects (HGP) bekannt gab, also die gelungene Entschlüsselung des menschlichen Erbguts, mag für die Menschheit ein epochales Schicksalsdatum darstellen, ähnlich jenem 20. Juli 1969, an welchem Neil Armstrong als erster Mensch außerirdischen (Mond-)Boden betrat. Für mich war es mehr, etwas besonderes, ein Outing gewissermaßen.
     Haben Sie sich nie gefragt, wessen Genom, stellvertretend für die menschliche Gattung nun konkret sequenziert wurde?
     In den verschiedenen Zentren des weltweit koordinierten Projektes griff man natürlich auf das Erbmaterial verschiedener und natürlich ausgewählter Exemplare des Homo Sapiens zurück.
     Craig Venter legte besonderen Wert auf eine, nun, etwas »elitäre« Auswahl jenes prototypischen, menschlichen Erbmaterials.
     Mit anderen Worten: er stellte sich bzw. eine eigene Körperzelle zur Entschlüsselung bereit.
     Sie wissen ja, der Bauplan jedes Lebewesens, die DNA, steckt als sich selbst entpackende EXE - Datei ausnahmslos in allen Zellen des Organismus.
     Aus Craig Venters Umfeld wird kolportiert, die von ihm bereitgestellte Zelle stamme aus einer Schuppe, die ihm vom fast kahlen Haupte fiel.
     Wie auch immer, Venter ist zwar monoman, dennoch lässt er einige wenige neben sich gelten.
     Jedenfalls trat er 1998 an Udo Schultz heran, damals International Chairman von MENSA, und brachte in einer für ihn typischen Weise sein Anliegen vor:
     »Udo, I need a real German genius, someone like Einstein or that. Do you know somebody? I can't stand all those other fucking American bastards!«
     Zwei Tage später rief mich Udo an. Craig wolle für sein Projekt auch eine deutsche DNA, ob ich mich bzw. meine DNA nicht zur Verfügung stellen möchte.
     Ich wusste natürlich von dem Projekt und, gut, ich fühlte mich geschmeichelt. Aber wollte ich wirklich bis in die letzten Basen meiner Existenz bzw. meiner DNA durchleuchtet sein?
     Ich erbat mir zwei Tage Bedenkzeit.
     Es wurde ein faustisches Ringen mit mir selbst. Alas! oder pourqoi pas?
     Am Ende obsiegten Neugier und Ethos: Wenn es denn der Wissenschaft und der Wahrheitsfindung dient.
     So spendete ich am Tag darauf Blut und Zelle für jenen höheren Zweck.
     Craig hielt mich über den Fortgang meiner Sequenzierung auf dem Laufenden. Im Abstand weniger Wochen wurden nach und nach meine 23 Chromosomen geknackt.
     2 Tage vor der offiziellen Bekanntgabe im Weißen Haus erhielt ich aus den Staaten eine eMail mit nur 3 Worten: It's done!
     Es war vollbracht.
     Inzwischen wurde ich für meine Teilnahme mit einer DVD beschenkt, auf der mein kompletter genetischer Code gespeichert ist.
     Beigefügt auch ein kurzes Schreiben des amerikanischen Präsidenten:
     »On behalf of the American people I would like to thank you for the important role you have played in this remarkable scientific achievement
     Die üblichen großen Worte.
     Ich selbst bin nun ganz mit dem Studium meiner DNA-DVD beschäftigt. Es ist dies die finale Phase meiner Selbstfindung.
     Es geht nicht mehr um Biologie, in meinen Genen suche ich in Wirklichkeit Geist und Gott.
     Haben Sie schon einmal erlebt, wie kahlköpfige Jungs in Springerstiefeln beim Anblick von Menschen mit dunkler Pigmentierung manchmal mit Grunzlauten und affenartigem Gang und Gesten reagieren?
     Eine tiefe Wahrheit wohnt dem inne:
Nur wenige Promille unterscheiden den Menschen von seinem tierischen Vetter.
     Mein (und Ihr!) Genom sind nämlich zu über 99% mit dem eines Schimpansen identisch.
     Mit anderen Worten: Der Ursprung des Geistes liegt in geringfügigen genetischen Differenzen der Hominiden, die demnächst exakt lokalisiert werden können.
     In der noch andauernden Kartierung des Schimpansen-Genoms wurden bereits auf dessen DNA-Strang Abschnitte gefunden, die Ähnlichkeit zu jenen Abschnitten der menschlichen DNA aufweisen, die vermutlich die Herausbildung mentaler Funktionen steuern.
     Ich scheue mich nicht, Ihnen eine heiße Spur zu präsentieren, die ich derzeit verfolge.
     Sie sehen unten eine Gegenüberstellung »verdächtig« ähnlicher Abschnitte meiner geisthaltigen DNA (1) und der etwas haarigeren DNA (2) des Schimpansen.
     Die vier kombinierten Lettern des genetischen Alphabets: A,T,G,C, die Bits der Biologie, stehen bekanntlich für die Basen Adenin, Thymian, Guanin und Cytosin.

  1. TCAGCCTACGTTATACTACAHAAHATACTGCCGAGCCGAGAACGA
  2. TCAGCCTACGTTATACTACGAGAGATACTGCCGAGCCGAGAACGA
Schreiben Sie mir, wenn es Ihnen gelingt, in diesem Buchstabengewirr die entscheidenden Unterschiede zu entdecken!
     Der Lohn für diese intellektuelle Herausforderung könnte ein tieferer Einblick in die wahre Natur des Geistes sein.

Ihr Wilhelm Weller


Wahre Worte - August 2000SeitenanfangWahre Worte - Juni 2000